Skip to Content
Merck
All Photos(1)

Key Documents

EHU131291

Sigma-Aldrich

MISSION® esiRNA

targeting human MTA1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCCCTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGCATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCTGAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGCGTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGGGCCTGCGAGAGCTGTTACACCACACAGTCTTACCAGTGGTATTCTTGGGGTCCCCCTAACATGCAGTGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTTGAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S Deivendran et al.
Scientific reports, 7, 44225-44225 (2017-04-11)
Despite a recognized role of DNA methyltransferase 3a (DNMT3a) in human cancer, the nature of its upstream regulator(s) and relationship with the master chromatin remodeling factor MTA1, continues to be poorly understood. Here, we found an inverse relationship between the
Yongqin Pan et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1398-1406 (2016-10-25)
Dysregulation of microRNAs is involved in the initiation and progression of several human cancers, including breast cancer, as strong evidence of miRNAs acting as oncogenes or tumour suppressor genes has been found. This study was performed to investigate the biological
Wenhao Weng et al.
International journal of oncology, 44(3), 812-818 (2014-01-16)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignant tumors. Upregulation of metastasis-associated protein 1 (MTA1) has been reported to contribute to the development of esophageal squamous cell carcinoma. Therefore, the objective of our study was to identify
Hong Zhang et al.
Acta biochimica et biophysica Sinica, 47(7), 496-503 (2015-05-23)
Metastasis-associated gene 1 (MTA1) is associated with cell growth, metastasis, and survival in non-small-cell lung cancer (NSCLC). Several previous reports have demonstrated that microRNAs affect gene expression through interaction between their seed region and the 3'-untranslated region of the target
Ioannis Sanidas et al.
Molecular cell, 73(5), 985-1000 (2019-02-04)
Hyper-phosphorylation of RB controls its interaction with E2F and inhibits its tumor suppressor properties. However, during G1 active RB can be mono-phosphorylated on any one of 14 CDK phosphorylation sites. Here, we used quantitative proteomics to profile protein complexes formed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service