Skip to Content
Merck
All Photos(1)

Key Documents

EHU072211

Sigma-Aldrich

MISSION® esiRNA

targeting human DKK3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCACCCTCAATGAGATGTTCCGCGAGGTTGAGGAACTGATGGAGGACACGCAGCACAAATTGCGCAGCGCGGTGGAAGAGATGGAGGCAGAAGAAGCTGCTGCTAAAGCATCATCAGAAGTGAACCTGGCAAACTTACCTCCCAGCTATCACAATGAGACCAACACAGACACGAAGGTTGGAAATAATACCATCCATGTGCACCGAGAAATTCACAAGATAACCAACAACCAGACTGGACAAATGGTCTTTTCAGAGACAGTTATCACATCTGTGGGAGACGAAGAAGGCAGAAGGAGCCACGAGTGCATCATCGACGAGGACTGTGGGCCCAGCATGTACTGCCAGTTTGCCAGCTTCCAGTACACCTGCCAGCCATGCCGGGGCCAGAGGATGCTCTGCACCCGGGACAGTGAGTGCTGTGGAGACCAGCTGTGTGTCTGGGGTCACTG

Ensembl | human accession no.

ENSG00000050165

NCBI accession no.

NM_013253

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DKK3(27122) , DKK3(27122)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Liu et al.
Experimental and therapeutic medicine, 18(6), 4747-4757 (2019-11-28)
MicroRNA-1303 (miR-1303) is involved in the tumorigenesis and progression of several cancers, and yet the role of miR-1303 in prostate cancer (PCa) and its underlying mechanism are unknown. To explore this issue, the present study aimed to use PCa tissues
Gang Peng et al.
Experimental and therapeutic medicine, 18(1), 769-778 (2019-07-02)
MicroRNAs (miRs) serve important roles in glioma. However, the underlying molecular mechanism of miR-25 in glioma progression remains largely unknown; therefore, it was investigated in the present study. RT-qPCR analysis revealed that miR-25 expression levels were markedly increased in human
Zainab Al Shareef et al.
Oncogene, 37(39), 5305-5324 (2018-06-03)
Aberrant transforming growth factor-β (TGF-β) signaling is a hallmark of the stromal microenvironment in cancer. Dickkopf-3 (Dkk-3), shown to inhibit TGF-β signaling, is downregulated in prostate cancer and upregulated in the stroma in benign prostatic hyperplasia, but the function of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service