Skip to Content
Merck
All Photos(1)

Key Documents

EHU039471

Sigma-Aldrich

MISSION® esiRNA

targeting human NBN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATGCTCCAAAGGCAAGGTCTTAGACCTATTCCTGAAGCAGAAATTGGATTGGCGGTGATTTTCATGACTACAAAGAATTACTGTGATCCTCAGGGCCATCCCAGTACAGGATTAAAGACAACAACTCCAGGACCAAGCCTTTCACAAGGCGTGTCAGTTGATGAAAAACTAATGCCAAGCGCCCCAGTGAACACTACAACATACGTAGCTGACACAGAATCAGAGCAAGCAGATACATGGGATTTGAGTGAAAGGCCAAAAGAAATCAAAGTCTCCAAAATGGAACAAAAATTCAGAATGCTTTCACAAGATGCACCCACTGTAAAGGAGTCCTGCAAAACAAGCTCTAATAATAATAGTATGGTATCAAATACTTTGGCTAAGATGAGAATCCCAAACTATCAGCTTTCACCAACTAAATTGCCAAGTATAAATAAAAGTAAAGATAGGGCTTCTCAGCAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Katie Myers et al.
PLoS genetics, 5(1), e1000324-e1000324 (2009-01-03)
The related PIK-like kinases Ataxia-Telangiectasia Mutated (ATM) and ATM- and Rad3-related (ATR) play major roles in the regulation of cellular responses to DNA damage or replication stress. The pro-apoptotic role of ATM and p53 in response to ionizing radiation (IR)
Artem K Velichko et al.
Nucleic acids research, 47(13), 6811-6825 (2019-05-23)
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a
Daniel C Anacker et al.
Journal of virology, 88(15), 8528-8544 (2014-05-23)
Activation of the ATM (ataxia telangiectasia-mutated kinase)-dependent DNA damage response (DDR) is necessary for productive replication of human papillomavirus 31 (HPV31). We previously found that DNA repair and homologous recombination (HR) factors localize to sites of HPV replication, suggesting that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service