Skip to Content
Merck
All Photos(1)

Key Documents

EMU030541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usf1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGATCCAGGGAGCTTTCACCAGTGACGATGCCGTTGACACGGAGGGAGCAGCTGCTGAGACACATTATACATATTTCCCCAGCACCGCAGTGGGAGATGGGTCAGGGGGCACCACATCTGGGAGTACAACAGCTGTTGTTACCACCCAGGGCTCAGAGGCACTACTGGGGCAGGCAACCCCGCCCAGCACAGGTCAATTCTTTGTGATGATGTCACCACAAGAAGTATTGCAGGGAGGGAGCCAGCGATCGATTGCCCCCAGGACCCACCCTTATTCCCCGAAGTCAGAGGCTCCCAGGACAACACGAGATGAGAAACGGAGGGCTCAACATAACGAAGTGGAGCGCCGCCGCCGGGACAAGATCAACAACTGGATTGTACAGCTGTCCAAAATCATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAAAGGTGGAATCCTGTCCAAAGCCTGTGATT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Chen-Chia Hung et al.
The Journal of general virology, 96(9), 2855-2866 (2015-08-25)
During its lytic cycle, Epstein-Barr virus (EBV) expresses Rta, a factor encoded by BRLF1 that activates the transcription of viral lytic genes. We found that upstream stimulating factor (USF) binds to E1, one of the five E boxes located at

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service