Skip to Content
Merck
All Photos(1)

Key Documents

EMU015001

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xrcc3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGTCACTAGGGGCTTCAGAAGAGCGCCTCTCTCCAGCCCTTGGCATCACCTGGGCTAACCAGCTCCTGATGCGACTGATGGTTGACCGCACCCATGAGGACGATGTTACCACAGGCTTGCCCAGAAGCCCAGTTCGGACTCTCCGAGTGCTCTTCGCCCCCCACCTACCCCTCTCCTCCTGCTGCTACACAGTCAGTGGGGAAGGCATTAGGGGGATGCCAGGAACACAGTCCTACTAACAGTGAGACCAGTGGGTCAGCCTGAGCAGGTCCCAAGGAACCCTGATTCTGATGACTCTTTCCAACAACCTGTCAGTCAGTGGCACCTGGTGAACAGGCACCCAGTGACGGTTAGTCTGTCAGTATCTGCTCTCTCCTCCCTGGGGTTCACCTACCCATTAGAGGATGACTGAGCAGCAGGAGCTCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service