Skip to Content
Merck
All Photos(1)

Key Documents

EHU052661

Sigma-Aldrich

MISSION® esiRNA

targeting human CSF1R

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGGCGTCGACTATAAGAACATCCACCTCGAGAAGAAATATGTCCGCAGGGACAGTGGCTTCTCCAGCCAGGGTGTGGACACCTATGTGGAGATGAGGCCTGTCTCCACTTCTTCAAATGACTCCTTCTCTGAGCAAGACCTGGACAAGGAGGATGGACGGCCCCTGGAGCTCCGGGACCTGCTTCACTTCTCCAGCCAAGTAGCCCAGGGCATGGCCTTCCTCGCTTCCAAGAATTGCATCCACCGGGACGTGGCAGCGCGTAACGTGCTGTTGACCAATGGTCATGTGGCCAAGATTGGGGACTTCGGGCTGGCTAGGGACATCATGAATGACTCCAACTACATTGTCAAGGGCAATGCCCGCCTGCCTGTGAAGTGGATGGCCCCAGAGAGCATCTTTGACTGTGTCTACACGGTTCAGAGCGACGTCTGGTCCTATGGCATCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ladonya Jackson et al.
Journal of neuroinflammation, 17(1), 137-137 (2020-04-30)
Unfortunately, over 40% of stroke victims have pre-existing diabetes which not only increases their risk of stroke up to 2-6 fold, but also worsens both functional recovery and the severity of cognitive impairment. Our lab has recently linked the chronic
Thidarath Rattanaburee et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110361-110361 (2020-06-15)
Kusunokinin, a lignan compound, inhibits cancer cell proliferation and induces apoptosis; however, the role of kusunokinin is not fully understood. Here, we aimed to identify a target protein of (-)-kusunokinin and determine the protein levels of its downstream molecules. We
Qiang Chen et al.
Fish & shellfish immunology, 45(2), 386-398 (2015-05-10)
Colony-stimulating factor 1 receptor (CSF1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although CSF1R gene has been identified and functionally studied in many fish, the precise role of CSF1R in grass carp (Ctenopharyngodon idellus) remains unclear. In this study, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service