Skip to Content
Merck
All Photos(1)

Key Documents

EHU028861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1R

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGAATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAGAAGGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lu Chen et al.
OncoTargets and therapy, 12, 907-919 (2019-02-19)
A variety of microRNAs (miRNAs) are aberrantly expressed in acute myeloid leukemia (AML), and these dysregulated miRNAs perform crucial roles in tumorigenesis and progression of AML. miR-628-3p (miR-628), one of the miRNAs dysregulated in multiple types of human cancers, exerts
Bao-Feng Li et al.
Human cell, 30(4), 311-318 (2017-08-11)
In recent years, some studies have been made on the effects of circular RNA (circRNA) in osteoarthritis (OA) and so on; however, its mechanisms remain to be further explored. Studies have shown that tumor necrosis factor-alpha can inhibit hsa_circ_0045714 expression
Tomokazu Ohnuma et al.
Archives of biochemistry and biophysics, 635, 66-73 (2017-10-21)
Many lines of evidence demonstrate that transcription factor nuclear factor-E2-related factor 2 (Nrf2) plays essential roles in cancer cell proliferation and resistance to chemotherapy, thereby indicating that suppression of abnormal Nrf2 activation is needed for a new therapeutic approach. Our
Li-Li Mei et al.
Cancer biomarkers : section A of Disease markers, 20(4), 527-537 (2017-08-12)
miR-99a is down-regulated in esophageal squamous cell carcinoma (ESCC), however the role and underlying mechanism are still unknown. We aim to explore the role and mechanism of miR-99a down-regulation in ESCC. The expression of miR-99a in ESCC tissues and cell
Yann Neuzillet et al.
BMC cancer, 17(1), 636-636 (2017-09-09)
The insulin growth factor (IGF) pathway has been proposed as a potential therapeutic target in bladder cancer. We characterized the expression of components of the IGF pathway - insulin growth factor receptors (INSR, IGF1R, IGF2R), ligands (INS, IGF1, IGF2), and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service