Skip to Content
Merck
All Photos(1)

Key Documents

EHU022031

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT6

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCCAAAGCCACTATCCTGTGGGACAATGCCTTCTCTGAGATGGACCGCGTGCCCTTTGTGGTGGCTGAGCGGGTGCCCTGGGAGAAGATGTGTGAAACTCTGAACCTGAAGTTCATGGCTGAGGTGGGGACCAACCGGGGGCTGCTCCCAGAGCACTTCCTCTTCCTGGCCCAGAAGATCTTCAATGACAACAGCCTCAGTATGGAGGCCTTCCAGCACCGTTCTGTGTCCTGGTCGCAGTTCAACAAGGAGATCCTGCTGGGCCGTGGCTTCACCTTTTGGCAGTGGTTTGATGGTGTCCTGGACCTCACCAAACGCTGTCTCCGGAGCTACTGGTCTGACCGGCTGATCATTGGCTTCATCAGCAAACAGTACGTTACTAGCCTTCTTCTCAATGAGCCCGACGGAACCTTTCTCCTCCGCTTCAGCGACTCAGAGATTGGGGGCATCACCATTGCCCATGTCATCCGGGGCCAGGATGGCTCTCCACAGAT

Ensembl | human accession no.

ENSG00000166888

NCBI accession no.

NM_003153

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STAT6(6778) , STAT6(6778)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tian Qing et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 1-6 (2017-05-20)
Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC)
Zachary P McKay et al.
Journal of immunology (Baltimore, Md. : 1950), 206(6), 1385-1394 (2021-01-29)
Crosstalk between costimulatory and coinhibitory ligands are a prominent node of immune cell regulation. Mounting evidence points toward a critical role for CD155, the poliovirus receptor, in suppressing T cell function, particularly in cancer. However, relative to other known costimulatory/coinhibitory
Li Yang et al.
Cellular & molecular immunology, 13(5), 669-677 (2015-07-21)
The etiology and the underlying mechanism of CD4(+) T-cell polarization are unclear. This study sought to investigate the mechanism by which interleukin (IL)-13 prevents the activation-induced apoptosis of CD4(+) T cells. Here we report that CD4(+) T cells expressed IL-13
Kristine C Olson et al.
Cytokine, 111, 551-562 (2018-11-21)
Calcitriol, the active form of vitamin D, has been well documented to act directly on immune cells and malignant cells. Activated T cells are one of the best characterized targets of calcitriol, with effects including decreasing inflammatory cytokine output and
Noelia Keiran et al.
Nature immunology, 20(5), 581-592 (2019-04-10)
Succinate is a signaling metabolite sensed extracellularly by succinate receptor 1 (SUNCR1). The accumulation of succinate in macrophages is known to activate a pro-inflammatory program; however, the contribution of SUCNR1 to macrophage phenotype and function has remained unclear. Here we
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service