Skip to Content
Merck
All Photos(1)

Key Documents

EMU071131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nfkb1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAGGCAGCACATAGATGAACTCCGGGATAGTGACAGCGTCTGTGACAGTGGTGTGGAGACATCCTTCCGCAAACTCAGCTTTACAGAGTCTCTTACTGGAGACAGCCCACTGCTATCTCTGAACAAAATGCCCCACGGTTATGGGCAGGAAGGACCTATTGAAGGCAAAATTTAGCCTGCTGGCCGTTCCCCCACACTGTGTAAACCAAAGCCCTGACAGTCCATTGCATCGTCCCAAAGGAGGAAGGCAAAGCGAATCCAAAGGTGCTGGAGAATCGCCGGCCTGCAGGGTCACTCGATTTCATTCAAGGCCTTCCGAATTTGGCGTCCTTCTTGGTTCTGAAATGAAATGTAGTTGCCACGCACAGACGGTGTCTAGCAATCATGGCGCTCGCTCGCTCAGCTGCACTCTATGGCTCAGGTGCAGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tong Yuan et al.
The Journal of surgical research, 192(1), 150-162 (2014-06-24)
Lidocaine has been used as a local anesthetic with anti-inflammatory properties, but its effects on neuroinflammation have not been well defined. In the present study, we investigated the prophylactic effects of lidocaine on lipopolysaccharide (LPS)-activated microglia and explored the underlying
Ujjal Das et al.
PloS one, 9(5), e97599-e97599 (2014-05-24)
Ionizing radiation is responsible for oxidative stress by generating reactive oxygen species (ROS), which alters the cellular redox potential. This change activates several redox sensitive enzymes which are crucial in activating signaling pathways at molecular level and can lead to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service