Skip to Content
Merck
All Photos(1)

Key Documents

EHU157721

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB25

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATGAGTTCAGCCACGACAGCCGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTGATGTTGGGCACCGCTGCTGTCAAGGCTCAGATCTGGGACACAGCTGGCCTGGAGCGGTACCGAGCCATCACCTCGGCGTACTATCGTGGTGCAGTGGGGGCCCTCCTGGTGTTTGACCTAACCAAGCACCAGACCTATGCTGTGGTGGAGCGATGGCTGAAGGAGCTCTATGACCATGCTGAAGCCACGATCGTCGTCATGCTCGTGGGTAACAAAAGTGACCTCAGCCAGGCCCGGGAAGTGCCCACTGAGGAGGCCCGAATGTTCGCTGAAAACAATGGACTGCTCTTCCTGGAGACCTCAGCCCTGGACTCTACCAATGTTGAGCTAGCCTTTGAGACTGTCCTGAAAGAAATCTTTGCGAAGGTGTCCAAGCAGAGACAGAACAGCATCCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sehime Gulsun Temel et al.
Apoptosis : an international journal on programmed cell death, 25(11-12), 799-816 (2020-09-10)
Ovarian cancer remains one of the most frequent causes of cancer-related death in women. Many patients with ovarian cancer suffer from de novo or acquired resistance to chemotherapy. Here, we report that RAB25 suppresses chemotherapy-induced mitochondrial apoptosis signaling in ovarian
Moorthy Krishnan et al.
Molecular biology of the cell, 24(6), 818-831 (2013-01-25)
Rab25 is a tumor suppressor for colon cancer in humans and mice. To identify elements of intestinal polarity regulated by Rab25, we developed Caco2-BBE cell lines stably expressing short hairpin RNA for Rab25 and lines rescuing Rab25 knockdown with reexpression
Ukhyun Jo et al.
Oncotarget, 5(5), 1265-1278 (2014-03-25)
Oncogenic alterations of epidermal growth factor receptor (EGFR) signaling are frequently observed in lung cancer patients with worse differentiation and poor prognosis. However, the therapeutic efficacy of EGFR-tyrosine kinase inhibitors (TKIs) is currently limited in selected patients with EGFR mutations.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service