Skip to Content
Merck
All Photos(1)

Key Documents

EHU140721

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CR1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGAAGGGA

Ensembl | human accession no.

ENSG00000168329

NCBI accession no.

NM_001337

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CX3CR1(1524) , CX3CR1(1524)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lisa Rooper et al.
Journal of ovarian research, 6(1), 57-57 (2013-08-21)
The goal of this study was to determine a predominant cell type expressing fractalkine receptor (CX3CR1) in mature ovarian teratomas and to establish functional significance of its expression in cell differentiation. Specimens of ovarian teratoma and human fetal tissues were
Yoshimi Enose-Akahata et al.
Retrovirology, 9, 16-16 (2012-02-18)
The activation of mononuclear phagocytes (MPs), including monocytes, macrophages and dendritic cells, contributes to central nervous system inflammation in various neurological diseases. In HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP), MPs are reservoirs of HTLV-I, and induce proinflammatory cytokines and excess T
Jun Tang et al.
Neuropharmacology, 119, 157-169 (2017-02-06)
Microglia play dual roles after germinal matrix hemorrhage, and the neurotrophic phenotype maybe neuroprotective. However, the phenotype transformation and the way by which neuron-microglia dialogue remain unclear. We raise the hypothesis that a cannabinoid receptor2 agonist (JWH133) accelerates the CX3CR1
Sheng-Mou Hou et al.
Arthritis research & therapy, 19(1), 282-282 (2017-12-23)
Osteoarthritis (OA) is a degenerative joint disease that affects the cartilage, synovium, and subchondral bone and is the leading cause of disability in older populations. Specific diagnostic biomarkers are lacking; hence, treatment options for OA are limited. Synovial inflammation is
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service