Skip to Content
Merck
All Photos(1)

Key Documents

EHU070911

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACGGGACAAATCCTAGAGGGTATAAAATCATCTCTGCTCAGATAATCATGACTTAGCAAGAATAAGGGCAAAAAATCCTGTTGGCTTAACGTCACTGTTCCACCCGGTGTAATATCTCTCATGACAGTGACACCAAGGGAAGTTGACTAAGTCACATGTAAATTAGGAGTGTTTTAAAGAATGCCATAGATGTTGATTCTTAACTGCTACAGATAACCTGTAATTGAGCAGATTTAAAATTCAGGCATACTTTTCCATTTATCCAAGTGCTTTCATTTTTCCAGATGGCTTCAGAAGTAGGCTCGTGGGCAGGGCGCAGACCTGATCTTTATAGGGTTGACATAGAAAGCAGTAGTTGTGGGTGAAAGGGCAGGTTGTCTTCAAACTCTGTGAGGTAGAATCCTTTGTCTATACCTCCATGAACATTGACTCGTGTGTTCAGAGCCTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Sun et al.
Cell death & disease, 11(6), 432-432 (2020-06-10)
Vascular remodeling can be caused by angiotensin II type 1 receptor (AT1R) autoantibody (AT1-AA), although the related mechanism remains unknown. Angiotensin II type 2 receptor (AT2R) plays multiple roles in vascular remodeling through cross-talk with AT1R in the cytoplasm. Here
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of
Jae Hoon Bahn et al.
Nature communications, 6, 6355-6355 (2015-03-10)
Adenosine deaminases acting on RNA (ADARs) are the primary factors underlying adenosine to inosine (A-to-I) editing in metazoans. Here we report the first global study of ADAR1-RNA interaction in human cells using CLIP-seq. A large number of CLIP sites are

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service