Skip to Content
Merck
All Photos(1)

Key Documents

EHU068681

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGGAGGTCTATGAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAGAAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAACCTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATCATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCCCTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTGGAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCTGAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jialin Qian et al.
Oncology letters, 11(3), 1738-1744 (2016-03-22)
Lung cancer, specifically non-small cell lung cancer (NSCLC), is the leading cause of cancer-associated mortality in the world. In previous years, almost no significant advancements have been made towards the molecular characterization of NSCLC, which highlights the requirement for novel
Chien-Chung Yang et al.
International journal of molecular sciences, 21(1) (2020-01-08)
Neuroinflammation is a landmark of neuroinflammatory and neurodegenerative diseases. Matrix metalloproteinase (MMP)-9, one member of MMPs, has been shown to contribute to the pathology of these brain diseases. Several experimental models have demonstrated that lipopolysaccharide (LPS) exerts a pathological role
Shaymaa Ik Al-Juboori et al.
Journal of experimental & clinical cancer research : CR, 38(1), 210-210 (2019-05-24)
Metformin, a biguanide, is one of the most commonly prescribed treatments for type 2 diabetes and has recently been recommended as a potential drug candidate for advanced cancer therapy. Although Metformin has antiproliferative and proapoptotic effects on breast cancer, the
Chih-Chung Lin et al.
Frontiers in molecular neuroscience, 10, 387-387 (2017-12-07)
Neurodegenerative disorders and brain damage are initiated by excessive production of reactive oxygen species (ROS), which leads to tissue injury, cellular death and inflammation. In cellular anti-oxidant systems, heme oxygenase-1 (HO-1) is an oxidative-sensor protein induced by ROS generation or
Qiaoqiao Wan et al.
Scientific reports, 7(1), 9033-9033 (2017-08-24)
Focal adhesion kinase (FAK) and Src family kinases (SFK) are known to play critical roles in mechanotransduction and other crucial cell functions. Recent reports indicate that they reside in different microdomains of the plasma membrane. However, little is known about

Global Trade Item Number

SKUGTIN
EHU068681-20UG4061831352009
EHU068681-50UG4061828385478

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service