Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU024041

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCAGCTTCCTGGAGACTTTGAAGACAGAGCGGCTGAGCCCAGACCTCCTGACCCTGGGACCTGCACTGCCTTCATCACTCCCTGTCCCCAATAGTGCTTATGGGGGCCCTGACTTTTCCAGTACCTTCTTTTCTCCCACCGGGAGCCCCCTCAATTCAGCAGCCTATTCCTCTCCCAAGCTTCGTGGAACTCTCCCCCTGCCTCCCTGTGAGGCCAGGGAGTGTGTGAACTGCGGAGCAACAGCCACTCCACTGTGGCGGAGGGACAGGACAGGCCACTACCTATGCAACGCCTGCGGCCTCTATCACAAGATGAATGGGCAGAACAGGCCCCTCATCCGGCCCAAGAAGCGCCTGATTGTCAGTAAACGGGCAGGTACTCAGTGCACCAACTGCCAGACGACCACCACGACACTGTGGCGGAGAAATGCCAGTGGGGATCCCGTGTGCAATGCCTGCGGCCTCTACTACAAGCTACACCAGGTGAACCG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Miranda L Xu et al.
Journal of neurochemistry, 146(4), 390-402 (2018-04-21)
Acetylcholinesterase (AChE; EC 3.1.1.7) is known to hydrolyze acetylcholine at cholinergic synapses. In mammalian erythrocyte, AChE exists as a dimer (G2 ) and is proposed to play role in erythropoiesis. To reveal the regulation of AChE during differentiation of erythroblast
Anouck Wijgaerts et al.
Haematologica, 102(4), 695-706 (2017-01-14)
Gray platelet syndrome is named after the gray appearance of platelets due to the absence of α-granules. It is caused by recessive mutations in
Pavel Burda et al.
PloS one, 11(3), e0152234-e0152234 (2016-03-25)
GATA-1 and PU.1 are two important hematopoietic transcription factors that mutually inhibit each other in progenitor cells to guide entrance into the erythroid or myeloid lineage, respectively. PU.1 controls its own expression during myelopoiesis by binding to the distal URE
A Maroz et al.
Leukemia, 28(6), 1259-1270 (2013-12-18)
Transient leukemia (TL) is evident in 5-10% of all neonates with Down syndrome (DS) and associated with N-terminal truncating GATA1 mutations (GATA1s). Here we report that TL-cell clones generate abundant eosinophils in a substantial fraction of patients. Sorted eosinophils from
John Timothy Caldwell et al.
PloS one, 8(7), e68601-e68601 (2013-07-23)
It has been previously shown that acute myeloid leukemia (AML) patients with higher levels of GATA1 expression have poorer outcomes. Furthermore, pediatric Down syndrome (DS) patients with acute megakaryocytic leukemia (AMKL), whose blast cells almost universally harbor somatic mutations in

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej