Skip to Content
Merck
All Photos(1)

Key Documents

EHU156631

Sigma-Aldrich

MISSION® esiRNA

targeting human NR0B2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGACCATCCTCTTCAACCCCGATGTGCCAGGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGGTGCTGTGTGAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCCTCCTCACGGCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTCGCCCTATCATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGTGACCTGTTCCAGCCCAGGCAGAGATCAGGTGGGCAGAGGCTGGCAGTGCTGATTCAGCCTGGCCATCCCCAGAGGTGACCCAATGCTCCTGGAGGGGGCAAGCCTGTATAGACAGCACTTGGCTCCTTAGGAACAGCTCTTCACTCAGCCACACCCCACATTGGACTTCCTTGGTTTGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jieqiong Wang et al.
Breast cancer research and treatment, 148(2), 279-289 (2014-10-11)
Signal transducer and activator of transcription 3 (STAT3) is implicated breast cancer metastasis and represents a potential target for developing new anti-tumor metastasis drugs. The purpose of this study is to investigate whether the natural agent 1'-acetoxychavicol acetate (ACA), derived
Tiantian Sun et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(17), 4689-4704 (2014-07-06)
The role and clinical implication of the transmembrane protein with EGF and two follistatin motifs 2 (TMEFF2) in gastric cancer is poorly understood. Gene expression profile analyses were performed and Gene Set Enrichment Analysis (GSEA) was used to explore its
Ji Hoon Jung et al.
British journal of pharmacology, 172(14), 3565-3578 (2015-04-01)
Epigallocatechin-3-gallate (EGCG) is a component of green tea known to have chemo-preventative effects on several cancers. However, EGCG has limited clinical application, which necessitates the development of a more effective EGCG prodrug as an anticancer agent. Derivatives of EGCG were
Ross C Gruber et al.
Glia, 63(10), 1753-1771 (2015-04-29)
We have previously described reduced myelination and corresponding myelin basic protein (MBP) expression in the central nervous system of Src homology 2 domain-containing protein tyrosine phosphatase 1 (SHP-1) deficient motheaten (me/me) mice compared with normal littermate controls. Deficiency in myelin
Chulwon Kim et al.
Molecular carcinogenesis, 53(10), 793-806 (2013-06-15)
Constitutive activation of STAT3 is frequently observed and closely linked with proliferation, survival, invasion, metastasis and angiogenesis in tumor cells. In the present study, we investigated whether β-caryophyllene oxide (CPO), a sesquiterpene isolated primarily from the essential oils of medicinal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service