Skip to Content
Merck
All Photos(1)

Key Documents

EHU086071

Sigma-Aldrich

MISSION® esiRNA

targeting human FAP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGTCCCTGCAGTCAGAGTGTAAGGTCTGTATTTGCTGTTAATTGGATATCTTATCTTGCAAGTAAGGAAGGGATGGTCATTGCCTTGGTGGATGGTCGAGGAACAGCTTTCCAAGGTGACAAACTCCTCTATGCAGTGTATCGAAAGCTGGGTGTTTATGAAGTTGAAGACCAGATTACAGCTGTCAGAAAATTCATAGAAATGGGTTTCATTGATGAAAAAAGAATAGCCATATGGGGCTGGTCCTATGGAGGATACGTTTCATCACTGGCCCTTGCATCTGGAACTGGTCTTTTCAAATGTGGTATAGCAGTGGCTCCAGTCTCCAGCTGGGAATATTACGCGTCTGTCTACACAGAGAGATTCATGGGTCTCCCAACAAAGGATGATAATCTTGAGCACTATAAGAATTCAACTGTGATGGCAAGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuli Lin et al.
Neoplasia (New York, N.Y.), 21(12), 1133-1142 (2019-11-24)
Desmoplasia is a hallmark of intrahepatic cholangiocarcinoma (ICC), which constitutes a barrier to infiltration of lymphocyte, but not myeloid cells. Given that dense desmoplastic stroma has been reported to be a barrier to infiltration of lymphocyte, but not myeloid cells.
Dimitrios Patsouras et al.
Molecular medicine reports, 11(6), 4585-4590 (2015-01-28)
Fibroblast activation protein (FAP), a selective protein for tumor stromal fibroblasts, is expressed in >90% of human epithelial carcinomas. A characteristic feature of pancreatic cancer is an extensive fibrotic or desmoplastic reaction surrounding the primary tumor. The present study aimed
Jochen Tillmanns et al.
Journal of molecular and cellular cardiology, 87, 194-203 (2015-09-01)
Fibroblast activation protein α (FAP) is a membrane-bound serine protease expressed by activated fibroblasts during wound healing in the skin. Expression of FAP after myocardial infarction (MI) and potential effects on cardiac wound healing are largely unknown. MI was induced

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service