Skip to Content
Merck
All Photos(1)

Key Documents

EHU046261

Sigma-Aldrich

MISSION® esiRNA

targeting human SETDB1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGGCAGTGGTTGAGGAACTGGGTATCTCTATGGAGGAACTTCGGCATTTCATCGATGAGGAACTGGAGAAGATGGATTGTGTACAGCAACGCAAGAAGCAGCTAGCAGAGTTAGAGACATGGGTAATACAGAAAGAATCTGAGGTGGCTCACGTTGACCAACTCTTTGATGATGCATCCAGGGCAGTGACTAATTGTGAGTCTTTGGTGAAGGACTTCTACTCCAAGCTGGGACTACAATACCGGGACAGTAGCTCTGAGGACGAATCTTCCCGGCCTACAGAAATAATTGAGATTCCTGATGAAGATGATGATGTCCTCAGTATTGATTCAGGTGATGCTGGGAGCAGAACTCCAAAAGACCAGAAGCTCCGTGAAGCTATGGCTGCCTTAAGAAAGTCAGCTCAAGATGTTCAGAAGTTCATGGATGCTGTCAACAAGAAGAGCAGTTCCCAGG

Ensembl | human accession no.

ENSG00000143379

NCBI accession no.

NM_012432

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SETDB1(9869) , SETDB1(9869)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yingjie Shao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 355-364 (2018-12-07)
Radiotherapy is one of the most important treatment methods of tumors. However, the application of radiotherapy in hepatocellular carcinoma (HCC) is limited due to the low tolerance of normal liver cells for radiation and inherent radiation resistance in HCC. With the
Sibel Özdaş
Turkish journal of biology = Turk biyoloji dergisi, 43(5), 281-292 (2019-11-27)
Head and neck cancer (HNC) is the sixth most common cancer worldwide and therefore presents a global public health problem. There are no standard algorithms for the diagnosis and follow-up of the disease, and no effective current treatment approaches exist.
Young Joon Song et al.
Molecules and cells, 38(4), 362-372 (2015-02-27)
Setdb1, an H3-K9 specific histone methyltransferase, is associated with transcriptional silencing of euchromatic genes through chromatin modification. Functions of Setdb1 during development have been extensively studied in embryonic and mesenchymal stem cells as well as neurogenic progenitor cells. But the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service