Skip to Content
Merck
All Photos(1)

Key Documents

EHU007521

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCH8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCATCAGATCTCTGCCATTCCATCCCAGGATGCCATCTCTGCTAGAGTCTACAGAAGTAAGACCAAAGAAAAGGAGAGGGAAGAACAGAATGAGAAGACTTTGGGACATTTCATGAGTCATTCAAGCAACATTTCTAAGGCTGGGAGTCCTCCGTCAGCATCAGCTCCGGCTCCGGTGTCCTCCTTCTCTCGCACTTCTATCACGCCATCCAGCCAGGACATCTGCAGGATCTGCCACTGTGAAGGAGATGATGAGAGCCCCCTGATCACCCCCTGCCACTGCACAGGAAGCCTCCACTTCGTGCACCAGGCCTGCCTGCAGCAGTGGATCAAGAGCTCCGACACGCGCTGCTGCGAGCTCTGCAAGTATGAGTTCATCATGGAGACCAAGCTGAAGCCACTGAGAAAATGGGAGAAGTTGCAGATGACGTCCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shanglin Guo et al.
Anatomical record (Hoboken, N.J. : 2007), 302(12), 2271-2278 (2019-08-24)
Tumor necrosis factor-α (TNF-α) is an important inflammatory cytokine that plays a key role in neuronal damage. Elevated expression of TNF-α is associated with numerous neurodegenerative diseases including Alzheimer's Disease and Parkinson's Disease. However, the specific mechanism of the signaling
Shivam Singh et al.
Cancer cell international, 17, 116-116 (2017-12-08)
Herein, for the first time, we report aberrant expression of membrane-associated RING-CH8 (MARCH8) in human esophageal squamous cell carcinoma. MARCH8 is a member of the recently discovered MARCH family of really interesting new genes (RING) E3 ligases. Though initial studies
Sriganesh B Sharma et al.
Molecular and cellular biology, 34(22), 4143-4164 (2014-09-10)
Despite the low prevalence of activating point mutation of RAS or RAF genes, the RAS-extracellular signal-regulated kinase (ERK) pathway is implicated in breast cancer pathogenesis. Indeed, in triple-negative breast cancer (TNBC), there is recurrent genetic alteration of pathway components. Using

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service