Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU002801

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGTGGACATCACCAGAAGCTATAGCCTACCGCAAGTTCACGTCAGCCAGCGATGTATGGAGTTATGGGATTGTTCTCTGGGAGGTGATGTCTTATGGAGAGAGACCATACTGGGAGATGTCCAATCAGGATGTAATTAAAGCTGTAGATGAGGGCTATCGACTGCCACCCCCCATGGACTGCCCAGCTGCCTTGTATCAGCTGATGCTGGACTGCTGGCAGAAAGACAGGAACAACAGACCCAAGTTTGAGCAGATTGTTAGTATTCTGGACAAGCTTATCCGGAATCCCGGCAGCCTGAAGATCATCACCAGTGCAGCCGCAAGGCCATCAAACCTTCTTCTGGACCAAAGCAATGTGGATATCACTACCTTCCGCACAACAGGTGACTGGCTTAATGGTGTCTGGACAGCACACTGCAAGGAAATCTTCACGGGTGTG

Ensembl | human accession no.

ENSG00000044524

NCBI accession no.

NM_005233

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EPHA3(2042) , EPHA3(2042)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hemei Xiao et al.
Cell biology international (2018-04-17)
MicroRNAs (miRNAs) play key roles in cervical cancer metastasis progression. Accumulated evidences have revealed that miRNAs are related to the pathophysiological process. However, the role of miR-340 in cervical cancer and how it works is still not fully interpreted. Using
Song Hee Kim et al.
Cellular signalling, 47, 122-130 (2018-04-14)
Radiotherapy is a well-established therapeutic modality used in the treatment of many cancers. However, radioresistance remains a serious obstacle to successful treatment. Radioresistance can cause local recurrence and distant metastases in some patients after radiation treatment. Thus, many studies have
Xiaole Chen et al.
Molecular cancer research : MCR, 16(5), 909-919 (2018-02-18)
The Hedgehog (Hh) receptor Patched1 (PTCH1) is a well-known tumor suppressor that in its active form represses Smoothened (SMO) activity, inhibits proliferation, and induces apoptosis. The cytoplasmic C-terminal domain (CTD) regulates PTCH1 turnover and nucleates a proapoptotic complex. In this
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service