Skip to Content
Merck
All Photos(1)

Key Documents

EHU009691

Sigma-Aldrich

MISSION® esiRNA

targeting human RND3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCGGCTGCAAGTCTGATCTGCGGACAGATGTTAGTACATTAGTAGAGCTCTCCAATCACAGGCAGACGCCAGTGTCCTATGACCAGGGGGCAAATATGGCCAAACAGATTGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAATAGCGTCAGAGACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCGGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGCTGCACTGTGATGTGAATCTTTCATTATCTTTAATGAAGACAAAGGAATCTAGTGTAAAAAACAACAGCAAACAAAAAGGTGAAGTCTAAATGAAGTGCACAGCCAAAGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chen Jiang et al.
Cancer research, 80(10), 1957-1969 (2020-02-16)
Nasopharyngeal carcinoma is an Epstein-Barr virus (EBV)-related malignancy. Recently, we found that the EBV-encoded miRNA BART2-5p was increased in the serum of patients with preclinical nasopharyngeal carcinoma and that the copy number positively correlated with disease progression. In this study
Marta Hernández-Sánchez et al.
Oncotarget, 6(19), 17479-17490 (2015-06-04)
RhoE is a small GTPase involved in the regulation of actin cytoskeleton dynamics, cell cycle and apoptosis. The role of RhoE in cancer is currently controversial, with reports of both oncogenic and tumor-suppressive functions for RhoE. Using RhoE-deficient mice, we
Kim Clarke et al.
PLoS genetics, 11(7), e1005325-e1005325 (2015-07-02)
Gliomas are a highly heterogeneous group of brain tumours that are refractory to treatment, highly invasive and pro-angiogenic. Glioblastoma patients have an average survival time of less than 15 months. Understanding the molecular basis of different grades of glioma, from

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service