Skip to Content
Merck
All Photos(1)

Key Documents

EMU000241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Orai3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTCCACCAGTCACCACACCAACGACTGCACAGATACGTGGAGCTTGCCTGGGGCTTCTCTACTGCCTTGGGTACCTTTCTCTTCCTGGCTGAAGTTGTTCTGGTGGGCTGGGTCAAGTTTGTGCCCATTGGGGCACCCATGGGTAAACCAGCTCCTGTTGTACCTATGTCCCAGGTGCCACCTGTGACTGTCTCCCTTAGTTTAGCTTCTAACCTCACACCATCCTCTGCTTCTATTACCACATCACAACAGCCTTCCAAAGCCTGTCCACCCCGGCAAGTGTGTGATAGTGCTCATGGACCAGGCTGGCAGGCAGCTATGGCCTCCACGGCAATCATGGTACCTGTGGGACTAGTGTTTATGGCCTTTGCCCTACATTTCTACCGATCCTTGGTTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service