Skip to Content
Merck
All Photos(1)

Key Documents

EHU083941

Sigma-Aldrich

MISSION® esiRNA

targeting human VEGFA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCCGAAACCATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCA

Ensembl | human accession no.

ENSG00000112715

NCBI accession no.

NM_001025366

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VEGFA(7422) , VEGF(7422)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhaohui Liu et al.
Molecular immunology, 106, 153-158 (2019-01-07)
MicroRNAs (miRNAs) play important roles in kidney development and maintenance of kidney physiological functions. MiR-377 has been reported to regulate inflammation in cardiac and cerebral ischemia. However, it remains unclear whether it has a similar function in renal ischemia/reperfusion (I/R).
So Yoon Ahn et al.
Experimental & molecular medicine, 50(4), 26-26 (2018-04-14)
We previously reported the role of vascular endothelial growth factor (VEGF) secreted by mesenchymal stem cells (MSCs) in protecting against neonatal hyperoxic lung injuries. Recently, the paracrine protective effect of MSCs was reported to be primarily mediated by extracellular vesicle
Alberto Ouro et al.
Experimental cell research, 361(2), 277-283 (2017-10-31)
The bioactive sphingolipid ceramide 1-phosphate (C1P) regulates cell division in a variety of cell types including macrophages. However, the mechanisms involved in this action are not completely understood. In the present work we show that C1P stimulates the release of
Huan Sun et al.
Journal of cellular physiology, 234(11), 20623-20633 (2019-04-21)
Myocardial ischemia is accompanied with hypoxia injury in myocardial cells. Long noncoding RNAs (lncRNA) CAMK2D-associated transcript 1 (C2dat1) C2dat1) has been linked with several ischemic diseases. However, the investigation regarding its role in myocardial ischemia is relatively rare. The aim
Jae Hyeop Lee et al.
Journal of controlled release : official journal of the Controlled Release Society, 263, 29-38 (2017-04-05)
RNA, one of the major biological macromolecules, has been considered as an attractive building material for bottom-up fabrication of nanostructures in the past few decades due to advancements in RNA biology, RNA chemistry and RNA nanotechnology. Most recently, an isothermal
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service