Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU015211

Sigma-Aldrich

MISSION® esiRNA

targeting human IVL

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGTCCCAGCAACACACACTGCCAGTGACCCTCTCCCCTGCCCTCAGTCAGGAGCTCCTCAAGACTGTTCCTCCTCCAGTCAATACCCATCAGGAGCAAATGAAACAGCCAACTCCACTGCCTCCCCCATGCCAGAAGGTGCCTGTCGAGCTCCCAGTGGAGGTCCCATCAAAGCAAGAGGAAAAGCACATGACTGCTGTAAAGGGACTGCCTGAGCAAGAATGTGAGCAACAGCAGAAGGAGCCACAGGAGCAGGAGCTGCAGCAACAGCACTGGGAACAGCATGAGGAATATCAGAAAGCAGAAAACCCAGAGCAGCAGCTTAAGCAGGAGAAAACACAAAGGGATCAGCAGCTAAACAAACAGCTGGAAGAAGAGAAGAAGCTCTTAGACCAGCAACTGGATCAAGAGCTAGTCAAGAGAGATGAGCAACTGGGAATGAAGAAAGAGCAACTGTTGGAGCTCCCAGAGCAGCAGGAGGGGCACCTGAAGCACCTAGAGCAGCAGGAG

Ensembl | human accession no.

ENSG00000163207

NCBI accession no.

NM_005547

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IVL(3713) , IVL(3713)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feng-Ning F Yuan et al.
International journal of oncology, 44(5), 1625-1633 (2014-03-15)
The secosteroidal hormone 1,25-dihyroxyvitamin D [1,25(OH)(2)D(3)] and its receptor, the vitamin D receptor (VDR), are crucial regulators of epidermal proliferation and differentiation. However, the effects of 1,25(OH)(2)D(3)-directed signaling on oral keratinocyte pathophysiology have not been well studied. We examined the
Roberta Lotti et al.
International journal of molecular sciences, 17(1) (2016-01-16)
Squamous Cell Carcinoma-derived Stem-like Cells (SCC-SC) originate from alterations in keratinocyte stem cells (KSC) gene expression and sustain tumor development, invasion and recurrence. Since survivin, a KSC marker, is highly expressed in SCC-SC, we evaluate its role in SCC-SC cell
Katiuscia Dallaglio et al.
International journal of molecular sciences, 14(10), 19540-19555 (2013-10-01)
In human epidermis, keratinocyte stem cells (KSC) are characterized by high levels of β1-integrin, resulting in the rapid adhesion to type IV collagen. Since epithelial tumors originate from KSC, we evaluated the features of rapidly adhering (RAD) keratinocytes derived from
Susanne Grether-Beck et al.
The Journal of investigative dermatology, 132(6), 1561-1572 (2012-03-16)
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service