Skip to Content
Merck
All Photos(1)

Key Documents

EMU150581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Camk2a

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGAGAGCACCAACACCACCATTGAGGACGAAGACACCAAAGTGCGCAAACAGGAAATTATCAAAGTGACAGAGCAGCTGATCGAAGCCATAAGCAATGGAGACTTTGAGTCCTACACGAAGATGTGCGACCCTGGAATGACAGCCTTTGAACCAGAGGCCCTGGGGAACCTGGTGGAGGGCCTGGACTTTCATCGATTCTATTTTGAAAACCTGTGGTCCCGGAACAGCAAGCCCGTGCACACCACCATCCTGAACCCTCACATCCACCTGATGGGTGACGAGTCAGCCTGCATCGCCTATATCCGCATCACTCAGTACCTGGATGCAGGCGGCATACCCCGCACGGCCCAGTCAGAGGAGACCCGCGTCTGGCACCGCAGGGACGGCAAATGGCAGATCGTCCACTTCCACAGATCTGGGGCGCCCTCCGTCCTGCCGCATTGAAGGACCAGGCCAGGGTCCCTGCGTCCTTGCTTCGCAGAGATCCGCTCTTTGTCCGTGGAATGT

Ensembl | mouse accession no.

ENSMUSG00000024617

NCBI accession no.

NM_009792

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CAMK2A(12322) , Camk2a(12322)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tae-Kyung Kim et al.
Neurobiology of disease, 79, 59-69 (2015-04-29)
Physical exercise is considered beneficial in the treatment of depression, but the underlying mechanism is not clearly understood. In the present study, we investigated the mechanism regulating antidepressant effects of exercise by focusing on the role of the amygdala using
Jie-Min Jia et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(41), 13725-13736 (2014-10-10)
Dysbindin is a schizophrenia susceptibility gene required for the development of dendritic spines. The expression of dysbindin proteins is decreased in the brains of schizophrenia patients, and neurons in mice carrying a deletion in the dysbindin gene have fewer dendritic
Xueyuan Zhou et al.
Immunology, 143(2), 287-299 (2014-04-30)
Prostaglandin E2 (PGE2 ) is an important inducer of inflammation, which is also closely linked to the progress of tumours. In macrophages, PGE2 production is regulated by arachidonic acid release and cyclooxygenase-2 (COX-2) expression. In the present study, we found
Luan Pereira Diniz et al.
Glia, 62(12), 1917-1931 (2014-07-22)
The balance between excitatory and inhibitory synaptic inputs is critical for the control of brain function. Astrocytes play important role in the development and maintenance of neuronal circuitry. Whereas astrocytes-derived molecules involved in excitatory synapses are recognized, molecules and molecular
Paul G Daft et al.
PloS one, 10(4), e0121568-e0121568 (2015-04-11)
Osteosarcoma (OS) is a hyperproliferative malignant tumor that requires a high vascular density to maintain its large volume. Vascular Endothelial Growth Factor (VEGF) plays a crucial role in angiogenesis and acts as a paracrine and autocrine agent affecting both endothelial

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service