Skip to Content
Merck
All Photos(1)

Key Documents

EMU077671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sod2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGAGCAAGGTCGCTTACAGATTGCTGCCTGCTCTAATCAGGACCCATTGCAAGGAACAACAGGCCTTATTCCGCTGCTGGGGATTGACGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAACGTCAGACCTGACTATCTGAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTTACTGAAAGATACACAGCTTGCAAGAAGTGAAACCTCACTCACGGCCACATTGAGTGCCAGGCTCCGGGCTGGTTTATAGTAGTGTAGAGCATTGCAGCACTATGACTGGGGTGCTGTAGTCTTTATTGATGTCTTTCCACATACCTGATAATTCTATGATAATTTCTTATTTTAATTAAATCTATTCTTAGGCAACTATTTGAGAACAGCGCATACTCTGTGTGAATTGCTCTTGATTGAACATTTTCGTTAGAGCCTTGAATTGCTTGGA

Ensembl | mouse accession no.

ENSMUSG00000006818

NCBI accession no.

NM_013671

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SOD2(20656) , Sod2(20656)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Y Xu et al.
Oncogene, 34(32), 4229-4237 (2014-11-05)
Manganese superoxide dismutase (MnSOD) is a mitochondrially localized primary antioxidant enzyme, known to be essential for the survival of aerobic life and to have important roles in tumorigenesis. Here, we show that MnSOD deficiency in skin tissues of MnSOD-heterozygous knockout
Vonetta M Williams et al.
Journal of virology, 88(12), 6751-6761 (2014-04-04)
High-risk types of human papillomavirus (HPV) are the causative agents of virtually all cases of cervical cancer and a significant proportion of other anogenital cancers, as well as both oral and pharyngeal cancers. The high-risk types encode two viral oncogenes
Jiahong Sun et al.
Molecular pharmacology, 88(3), 437-449 (2015-06-18)
Oxidative stress is linked to mitochondrial dysfunction in aging and neurodegenerative conditions. The transcription factor nuclear factor E2-related factor 2 (Nrf2)-antioxidant response element (ARE) regulates intracellular antioxidative capacity to combat oxidative stress. We examined the effect of tert-butylhydroquinone (tBHQ), an
Yasuhiro Ishihara et al.
The Journal of biological chemistry, 290(37), 22805-22817 (2015-08-02)
Microglia are activated quickly in response to external pathogens or cell debris and clear these substances via the inflammatory response. However, excessive activation of microglia can be harmful to host cells due to the increased production of reactive oxygen species
Sabrina Krautbauer et al.
Molecular and cellular biochemistry, 393(1-2), 69-76 (2014-04-18)
Adipogenesis is associated with the upregulation of the antioxidative enzyme manganese superoxide dismutase (MnSOD) suggesting a vital function of this enzyme in adipocyte maturation. In the current work, MnSOD was knocked-down with small-interference RNA in preadipocytes to study its role

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service