Skip to Content
Merck
All Photos(1)

Key Documents

EMU015631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lamp1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACATCAGCCCAAATGACACATCTAGTGGGAGTTGCGGTATCAACTTGGTGACCCTGAAAGTGGAGAACAAGAACAGAGCCCTGGAATTGCAGTTTGGGATGAATGCCAGCTCTAGCCTGTTTTTCTTGCAAGGAGTGCGCTTGAATATGACTCTTCCTGATGCCCTAGTGCCCACATTCAGCATCTCCAACCATTCACTGAAAGCTCTTCAGGCCACTGTGGGAAACTCATACAAGTGCAACACTGAGGAACACATCTTTGTCAGCAAGATGCTCTCCCTCAATGTCTTCAGTGTGCAGGTCCAGGCTTTCAAGGTGGACAGTGACAGGTTTGGGTCTGTGGAAGAGTGTGTTCAGGATGGTAACAACATGTTGATCCCCATTGCTGTGGGCGGTGCCCTGGCAGGGCTGATCCTCATCGTCCTCATTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Akhil Kumar Agarwal et al.
Biochemical and biophysical research communications, 449(3), 332-337 (2014-05-23)
Lysosome Associated Membrane Protein-1 (LAMP1), which lines the lysosomes, is often found to be expressed on surface of metastatic cells. We previously demonstrated that its surface expression on B16 melanoma variants correlates with metastatic potential. To establish the role of
Xiang Y Kong et al.
Disease models & mechanisms, 7(3), 351-362 (2014-02-04)
Human kidney predominant protein, NCU-G1, is a highly conserved protein with an unknown biological function. Initially described as a nuclear protein, it was later shown to be a bona fide lysosomal integral membrane protein. To gain insight into the physiological
Takahito Miyake et al.
Glia, 63(10), 1870-1882 (2015-05-27)
Microglia, the resident immune cells in the brain, survey the environment of the healthy brain. Microglial migration is essential for many physiological and pathophysiological processes. Although microglia express some members of the transient receptor potential (TRP) channel family, there is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service