Skip to Content
Merck
All Photos(1)

Key Documents

EHU009781

Sigma-Aldrich

MISSION® esiRNA

targeting human NRIP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGAAGAGGCTGTCTGATTCTATCATGAATTTAAACGTAAAGAAGGAAGCTTTGCTAGCTGGCATGGTTGACAGTGTGCCTAAAGGCAAACAGGATAGCACATTACTGGCCTCTTTGCTTCAGTCATTCAGCTCTAGGCTGCAGACTGTTGCTCTGTCACAACAAATCAGGCAGAGCCTCAAGGAGCAAGGATATGCCCTCAGTCATGATTCTTTAAAAGTGGAGAAGGATTTAAGGTGCTATGGTGTTGCATCAAGTCACTTAAAAACTTTGTTGAAGAAAAGTAAAGTTAAAGATCAAAAGCCTGATACGAATCTTCCTGATGTGACTAAAAACCTCATCAGAGATAGGTTTGCAGAGTCTCCTCATCATGTTGGACAAAGTGGAACAAAGGTCATGAGTGAACCGTTGTCATGTGCTGCAAGATTACAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongying Piao et al.
The journal of physiological sciences : JPS, 67(1), 141-150 (2016-03-28)
Estrogen withdrawal following menopause results in an increase of osteoclasts formation and bone resorption, which is one of the most important mechanisms of postmenopausal osteoporosis. Recently, growing evidence has suggested that receptor-interacting protein 140 was implicated in estrogen-regulated metabolic disease
J You et al.
Acta physiologica (Oxford, England), 220(1), 58-71 (2016-09-11)
The transcriptional cofactor receptor-interacting protein 140 (RIP140) is known as a deleterious regulator of cardiac mitochondrial function and energy metabolic homeostasis. This study revealed that RIP140 repressed Sirtuin 3 (SIRT3), a mitochondrial deacetylase that plays an important role in regulating
X F Ni et al.
Neoplasma, 65(6), 881-887 (2018-06-27)
Nuclear receptor interacting protein (NRIP1), also known as RIP140, is a transcriptional co-regulator required for the maintenance of energy homeostasis and ovulation. Although several studies have identified roles for NRIP1 in various cell processes, the biological functions of NRIP1 in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service