Skip to Content
Merck
All Photos(1)

Key Documents

EHU009031

Sigma-Aldrich

MISSION® esiRNA

targeting human TNNC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACAAGGCTGCGGTAGAGCAGCTGACAGAAGAGCAGAAAAATGAGTTCAAGGCAGCCTTCGACATCTTCGTGCTGGGCGCTGAGGATGGCTGCATCAGCACCAAGGAGCTGGGCAAGGTGATGAGGATGCTGGGCCAGAACCCCACCCCTGAGGAGCTGCAGGAGATGATCGATGAGGTGGACGAGGACGGCAGCGGCACGGTGGACTTTGATGAGTTCCTGGTCATGATGGTTCGGTGCATGAAGGACGACAGCAAAGGGAAATCTGAGGAGGAGCTGTCTGACCTCTTCCGCATGTTTGACAAAAATGCTGATGGCTACATCGACCTGGATGAGCTGAAGATAATGCTGCAGGCTACAGGCGAGACCATCACGGAGGACGACATCGAGGAGCTCATGAAGGACGGAGACAAGAACAACGACGGCCGCATCGACTATGATGAGTTCCTGGAGTTCATGAAGGGTGTGGAGTAGATGCTGACCTTCACCCAGAGCTGCCTATGCCCAGCCTCCAACTCCAGCTGAGTCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Juan L Vivero-Escoto et al.
Journal of materials chemistry. B, 7(46), 7396-7405 (2019-11-09)
Chronic liver dysfunction often begins with hepatic fibrosis. A pivotal event in the progression of liver fibrosis and cirrhosis is hepatic stellate cell (HSC) activation and secretion of extracellular matrix proteins, including tenascin-C (TnC). TnC is often chosen as a
Elena Jachetti et al.
Cancer research, 75(10), 2095-2108 (2015-03-27)
Precociously disseminated cancer cells may seed quiescent sites of future metastasis if they can protect themselves from immune surveillance. However, there is little knowledge about how such sites might be achieved. Here, we present evidence that prostate cancer stem-like cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service