Skip to Content
Merck
All Photos(1)

Key Documents

EMU066731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gnaq

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACAATTGGTTCGAGAGGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGCTTGTGGAATGATCCTGGAATCCAGGAGTGCTACGACAGACGACGGGAATATCAGTTATCTGACTCTACCAAATACTATCTGAATGACTTGGACCGTGTAGCCGACCCTTCCTATCTGCCTACACAACAAGACGTGCTTAGAGTTCGAGTCCCCACTACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCCATCATGTTTCTAGTAGCGCTTAGCGAATATGATCAAGTTCTTGTGGAGTCAGACAATGAGAACCGCATG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


  • Certificates of Analysis (COA)

    Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

    Already Own This Product?

    Find documentation for the products that you have recently purchased in the Document Library.

    Visit the Document Library

    Grazia Ambrosini et al.
    Molecular cancer therapeutics, 13(8), 2073-2080 (2014-06-06)
    The majority of uveal melanomas carry oncogenic mutations in the G proteins GNAQ and GNA11, with consequent activation of the MAPK pathway. Selective MEK inhibitors, such as selumetinib, have shown clinical benefit in uveal melanoma. However, mechanisms of drug resistance
    Honglei Liu et al.
    Oncology reports, 34(1), 295-301 (2015-05-09)
    The occurrence of guanine nucleotide binding protein (G protein), q polypeptide (GNAQ) mutations has been found to be high in the majority of uveal melanomas. However, the underlying molecular mechanism of GNAQ mutations in modulating uveal melanoma is poorly understood.

    Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

    Contact Technical Service