Skip to Content
Merck
All Photos(1)

Key Documents

EHU138771

Sigma-Aldrich

MISSION® esiRNA

targeting human NLGN2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGCCTTTGACTTCACTGTCTCCAACTTTGTGGACAACCTGTATGGCTACCCGGAAGGCAAGGATGTGCTTCGGGAGACCATCAAGTTTATGTACACAGACTGGGCCGACCGGGACAATGGCGAAATGCGCCGCAAAACCCTGCTGGCGCTCTTTACTGACCACCAATGGGTGGCACCAGCTGTGGCCACTGCCAAGCTGCACGCCGACTACCAGTCTCCCGTCTACTTTTACACCTTCTACCACCACTGCCAGGCGGAGGGCCGGCCTGAGTGGGCAGATGCGGCGCACGGGGATGAACTGCCCTATGTCTTTGGCGTGCCCATGGTGGGTGCCACCGACCTCTTCCCCTGTAACTTCTCCAAGAATGACGTCATGCTCAGTGCCGTGGTCATGACCTACTGGACCAACTTCGCCAAGACTGGGGACCCCAACCAGCCGGTGCCGCAGGATACCAAGTTCATCCACACCAAGCCCAATCGCTTCGAGGAGGTGGTGTGGAGCAAATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Margherita Pergolizzi et al.
Biochemical and biophysical research communications, 501(1), 165-171 (2018-05-02)
The synaptic protein Neuroligin 2, similarly to its isoform Neuroligin 1, is produced by endothelial cells, but its activity in the vascular context remains unknown. This study aimed at verifying the hypothesis that Neuroligin 2, in parallel with its extraneuronal
Luan Pereira Diniz et al.
Glia, 62(12), 1917-1931 (2014-07-22)
The balance between excitatory and inhibitory synaptic inputs is critical for the control of brain function. Astrocytes play important role in the development and maintenance of neuronal circuitry. Whereas astrocytes-derived molecules involved in excitatory synapses are recognized, molecules and molecular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service