Skip to Content
Merck
All Photos(1)

Key Documents

EHU059861

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53I3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGCAGAGACAAGGCCAGTATGACCCACCTCCAGGAGCCAGCAACATTTTGGGACTTGAGGCATCTGGACATGTGGCAGAGCTGGGGCCTGGCTGCCAGGGACACTGGAAGATCGGGGACACAGCCATGGCTCTGCTCCCCGGTGGGGGCCAGGCTCAGTACGTCACTGTCCCCGAAGGGCTCCTCATGCCTATCCCAGAGGGATTGACCCTGACCCAGGCTGCAGCCATCCCAGAGGCCTGGCTCACCGCCTTCCAGCTGTTACATCTTGTGGGAAATGTTCAGGCTGGAGACTATGTGCTAATCCATGCAGGACTGAGTGGTGTGGGCACAGCTGCTATCCAACTCACCCGGATGGCTGGAGCTATTCCTCTGGTCACAGCTGGCTCCCAGAAGAAGCTTCAAATGGCAGAAAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seon-Joo Park et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 21(2), 267-273 (2017-03-11)
The p53-inducible gene 3 (PIG3), initially identified as a gene downstream of p53, plays an important role in the apoptotic process triggered by p53-mediated reactive oxygen species (ROS) production. Recently, several studies have suggested that PIG3 may play a role
Min Jin et al.
Biomolecules & therapeutics, 25(4), 396-403 (2017-06-14)
Under normal, non-stressed conditions, intracellular p53 is continually ubiquitinated by MDM2 and targeted for degradation. However, in response to severe genotoxic stress, p53 protein levels are markedly increased and apoptotic cell death is triggered. Inhibiting the ubiquitination of p53 under

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service