MIRAP01424
MystiCq® microRNA qPCR Assay Primer
mmu-miR-717
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
form
liquid
concentration
10 mg/mL
mature sequence
CUCAGACAGAGAUACCUUCUCU
mp
~76.5 °C
Sanger mature/minor accession no.
shipped in
wet ice
storage temp.
−20°C
Gene Information
mouse ... MIR717(751531)
General description
The MystiCq® microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq® microRNA SYBR® Green qPCR ReadyMix™ on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.
Features and Benefits
- Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
- Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
- No self-complementarity or primer dimer artifacts with the Universal PCR Primer
- Optimized primer Tm designed to match the Universal PCR Primer
- Universal cycling conditions ensures robust amplification for all assays in profiling experiments
- Optimized PCR product Tm (75-78° C)
Legal Information
MystiCq is a registered trademark of QIAGEN Beverly Inc.
ReadyMix is a trademark of Sigma-Aldrich Co. LLC
SYBR is a registered trademark of Life Technologies
related product
Referencia del producto
Descripción
Precios
Storage Class
12 - Non Combustible Liquids
wgk_germany
WGK 1
flash_point_f
Not applicable
flash_point_c
Not applicable
Certificados de análisis (COA)
Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico