Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU210421

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Erbb2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTGTCCCCCGAACAACCAAGAGGTCACAGCTGAGGACGGAACACAGCGGTGTGAGAAATGCAGCAAGCCCTGTGCTGGAGTATGCTATGGTCTGGGCATGGAGCACCTCCGAGGGGCGAGGGCCATCACCAGTGACAATATCCAGGAGTTTGCTGGCTGCAAGAAGATCTTTGGGAGCCTGGCATTTTTGCCGGAGAGCTTTGATGGGAACCCCTCCTCCGGCGTTGCCCCACTGAAGCCAGAGCATCTCCAAGTGTTCGAAACCCTGGAGGAGATCACAGGTTACCTATACATTTCAGCATGGCCAGAGAGCTTCCAAGACCTCAGTGTCTTCCAGAACCTTCGGGTCATTCGGGGACGGATTCTCCATGATGGTGCTTACTCATTGACGTTGCAAGGCCTGGGGATTCACTCACTGGGGCTACGCTCACTGCGGGAGCTGGGCAGTGGATTGGCTCTCATTCACCGCAACACCCATCTCTGCTTTGTAAACACTGTACCTTGGGACCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chiao-Yun Lin et al.
Journal of molecular medicine (Berlin, Germany), 92(9), 969-981 (2014-05-14)
Endometrial cancers have been recently molecularly characterized; amplifications of human epidermal growth factor receptor 2 (HER2) were seen in 25 % of the serous-like tumors, and mutations in the PI(3)K/AKT pathways were seen in 93 % of endometrioid tumors. These new findings
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Yu-Chieh Tsai et al.
Molecular cancer therapeutics, 14(3), 810-820 (2015-01-16)
Blockade of EGFR has been proved useful in enhancing the effect of radiotherapy, but the advantages of new-generation EGFR tyrosine kinase inhibitors (TKI) in radiosensitization are not well known. We used two human bladder cancer cells with wild-type EGFR to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico