Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU078951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp9x

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCGAGCTATTGATCTCCTTAAAGAGATATACACAAACCTTGGTCCAAGGCTGCAGGTCAATCAGGTGGTGATCCATGAAGACTTCATTCAGTCTTGCTTTGATCGTTTGAAAGCCTCTTATGACACATTGTGTGTTTTGGATGGTGACAAAGACAGTATTAATTGTGCAAGACAGGAAGCTGTTCGAATGGTCCGAGTGTTAACTGTTCTAAGAGAATATATAAATGAATGTGACAGTGATTATCATGAAGAAAGAACAATTTTGCCTATGTCAAGAGCTTTCCGTGGTAAACACCTCTCTTTTATAGTTCGATTTCCAAACCAGGGCAGGCAAGTAGATGACTTGGAGGTTTGGTCTCATACAAATGATACCATTGGTTCAGTTCGAAGATGTATACTCAATCGTATTAAAGCCAATGTAGCTCATACAAAAATTGAACTCTTTGTGGGTGGTGAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jesse L Cox et al.
Cancer biology & therapy, 15(8), 1042-1052 (2014-05-21)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and deadly malignancies. Recently, the deubiquitinating protease USP9X has been shown to behave as an oncogene in a number of neoplasms, including those of breast, brain, colon, esophagus and lung
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Deepa Kushwaha et al.
Cancer biology & therapy, 16(3), 392-401 (2015-02-19)
Radiotherapy (RT) is vital for the treatment of locally advanced non-small cell lung cancer (NSCLC), yet its delivery is limited by tolerances of adjacent organs. We sought therefore to identify and characterize gene targets whose inhibition may improve RT. Whole

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico