Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU063451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdk5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATTTCGACAGCTGCAATGGTGACCTGGACCCTGAGATTGTGAAGTCATTCCTCTTCCAGCTGCTGAAAGGCCTGGGATTCTGTCACAGCCGCAACGTGCTACATAGGGACCTGAAGCCCCAGAACCTGCTCATAAACAGGAATGGGGAGTTGAAATTGGCTGATTTTGGCCTGGCCCGAGCCTTTGGTATCCCCGTCCGCTGCTACTCTGCTGAGGTGGTCACGCTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCTAATGCAGGACGACCTCTCTTCCCTGGCAATGATGTGGATGACCAGCTGAAGAGGATCTTCCGACTGCTAGGGACACCGACTGAGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Johanna Liebl et al.
Nature communications, 6, 7274-7274 (2015-06-02)
The lymphatic system maintains tissue fluid balance, and dysfunction of lymphatic vessels and valves causes human lymphedema syndromes. Yet, our knowledge of the molecular mechanisms underlying lymphatic vessel development is still limited. Here, we show that cyclin-dependent kinase 5 (Cdk5)
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it
Shu Zhang et al.
PloS one, 10(7), e0131833-e0131833 (2015-07-07)
Cyclin-dependent kinase 5 (CDK5) is a cytoplasmic serine/ threonine kinase. Knockdown of CDK5 enhances paclitaxel sensitivity in human ovarian cancer cells. This study explores the mechanisms by which CDK5 regulates paclitaxel sensitivity in human ovarian cancers. Multiple ovarian cancer cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico