Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU062051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tgm2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTGGTCAGCCTCAGTGCTGGACCAACAGGACAATGTCCTCTCGCTACAGCTCTGCACCCCAGCCAATGCTCCTATTGGCCTGTACCGTCTCAGCCTAGAGGCTTCTACTGGCTACCAGGGCTCCAGCTTTGTGCTGGGCCACTTCATCCTGCTCTACAATGCCTGGTGCCCAGCCGATGATGTGTACCTAGACTCAGAGGAGGAGCGACGGGAATATGTCCTTACGCAACAGGGCTTCATCTACCAAGGCTCTGTCAAGTTCATCAAGAGTGTGCCTTGGAACTTTGGGCAGTTCGAGGATGGAATCCTGGATACCTGCCTGATGCTCTTGGATATGAACCCCAAGTTCCTGAAGAACCGTAGTCGGGACTGCTCACGCCGCAGCAGTCCCATCTATGTGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Deborah T Leicht et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881 (2014-05-16)
Esophageal adenocarcinomas (EAC) are aggressive cancers that are increasing in incidence and associated with a poor prognosis. The identification of highly expressed genes in EAC relative to metaplastic Barrett's esophagus (BE) may provide new targets for novel early cancer detection
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for
Kaiser M Bijli et al.
Shock (Augusta, Ga.), 42(6), 562-569 (2014-07-25)
We addressed the role of transglutaminase 2 (TG2), a calcium-dependent enzyme that catalyzes cross-linking of proteins, in the mechanism of endothelial cell (EC) inflammation and lung polymorphonuclear lymphocyte (PMN) infiltration. Exposure of EC to thrombin, a procoagulant and proinflammatory mediator

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico