Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU052671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Msi1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTTCGGCTTCGTCACTTTCATGGACCAGGCGGGGGTGGATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCCAAGGTGGCCTTTCCTCGAAGAGCACAGCCTAAGATGGTCACTCGGACGAAGAAGATCTTCGTGGGGGGGCTGTCTGTGAACACCACGGTGGAAGATGTGAAACACTATTTCGAGCAGTTCGGAAAGGTGGATGATGCCATGCTGATGTTCGACAAAACCACCAACAGGCACAGAGGGTTTGGATTTGTCACGTTTGAGAGCGAGGACATCGTAGAGAAAGTTTGTGAGATCCACTTCCATGAAATCAACAACAAAATGGTGGAATGCAAGAAAGCCCAGCCAAAGGAGGTGATGTCCCCGACAGGCTCAGCCCGGGGCAGGTCTCGGGTCATGCCCTACGGAATGGATGCCTTCATGCTGGGTAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mitzli X Velasco et al.
RNA (New York, N.Y.), 25(7), 768-782 (2019-04-21)
RNA-binding proteins (RBPs) and miRNAs are critical gene expression regulators that interact with one another in cooperative and antagonistic fashions. We identified Musashi1 (Msi1) and miR-137 as regulators of a molecular switch between self-renewal and differentiation. Msi1 and miR-137 have
In-Sun Hong et al.
PloS one, 8(2), e56496-e56496 (2013-02-19)
Human umbilical cord blood (UCB)-derived mesenchymal stem cells (MSCs) are essential tools for regenerative medicine due to their capacity for self-renewal and multi-lineage differentiation. As MSCs are found in very small numbers in various tissues, in vitro cell expansion is
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico