Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU044441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ppargc1a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACAAGCACTTCGGTCATCCCTGTCAAGCTGTGTTTGACGACAAATCAGACAAGACCAGTGAACTAAGGGATGGCGACTTCAGTAATGAACAATTCTCCAAACTACCTGTGTTTATAAATTCAGGACTAGCCATGGATGGCCTATTTGATGACAGTGAAGATGAAAGTGATAAACTGAGCTACCCTTGGGATGGCACGCAGCCCTATTCATTGTTCGATGTGTCGCCTTCTTGCTCTTCCTTTAACTCTCCGTGTCGAGACTCAGTGTCACCACCGAAATCCTTATTTTCTCAAAGACCCCAAAGGATGCGCTCTCGTTCAAGATCCTTTTCTCGACACAGGTCGTGTTCCCGATCACCATATTCCAGGTCAAGATCAAGGTCCCCAGGCAGTAGATCCTCTTCAAGATCCTGTTACTACTATGAATCAAGCCACTACAGACACCGCACACACCGCAATTCTCCCTTGTATGTGAGATCACGTTCAAGGTCACCCTACAGCCGTAGGCCCAGGTACGACAGCTATGAAGCCTATGAGCACGAAAGGCTCAAGAGGGATGAATACCGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

Ppargc1a (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional co-activator. It is down-regulated in prostate cancer and is linked with disease progression. It plays an important role in mitochondrial function and biogenesis. Changes in the methylation pattern of the gene promoter causes changes in the mitochondrial DNA content. It controls endothelial homeostasis by participating in endothelial nitric oxide (NO) synthase (eNOS) activity and NO production. It plays an important role in insulin signaling. It is responsible for the activation of gluconeogenesis in hepatocytes, regulating thermogenesis in brown adipose tissue, fatty acid oxidation in the heart. It also controls reactive oxygen species production.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Epigenetic regulation of an adverse metabolic phenotype in polycystic ovary syndrome: the impact of the leukocyte methylation of PPARGC1A promoter.
Zhao H
Fertility and Sterility, 107, 467-467 (2017)
PGC-1a ameliorates AngiotensinII-induced eNOS dysfunction in human aortic endothelial cells.
Li J
Vascular Pharmacology, 83, 90-90 (2016)
Lack of direct evidence for natural selection at the candidate thrifty gene locus, PPARGC1A.
Cadzow M
BMC Medical Genetics, 17, 80-80 (2016)
Suppression of endothelial PGC-1a is associated with hypoxia-induced endothelial dysfunction and provides a new therapeutic target in pulmonary arterial hypertension.
Ye JX
American Journal of Physiology. Lung Cellular and Molecular Physiology, 310, L1233-L1233 (2016)
The metabolic co-regulator PGC1a suppresses prostate cancer metastasis.
Torrano V, et. al.
Nature Cell Biology, 18, 645-645 (2016)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico