Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU032471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chek2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACAAGCGCCTGAAAGAAGCCACCTGTAAGCTCTACTTCTACCAGATGCTTGTAGCTGTACAGTACCTTCACGAAAATGGGATCATACATCGGGACTTAAAGCCGGAGAATGTTCTTTTATCATCTCAGGAAGAGGATTGTCTAATCAAGATCACTGACTTTGGGCAGTCCAAGATCTTGGGGGAGACCTCCTTGATGAGAACCTTATGTGGTACGCCCACTTATCTGGCTCCTGAGGTTCTTGTCTCCAACGGGACTGCTGGGTACAGCCGCGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTCATCTGCCTAAGTGGGTATCCACCTTTCTCTGAGCATAAGACCCAAGTGTCCCTGAAGGATCAGATCACCAGTGGAAAGTACAACTTTATTCCTGAAGTCTGGACAGATGTCTCAGAGGAGGCTCTGGACCTTGTCAAGAAACTGTTAGTTGTAGACCCAAAGGCTCG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic
Chao-Ying Huang et al.
PloS one, 9(8), e104732-e104732 (2014-08-12)
In daily life, humans are exposed to the extremely low-frequency electromagnetic fields (ELF-EMFs) generated by electric appliances, and public concern is increasing regarding the biological effects of such exposure. Numerous studies have yielded inconsistent results regarding the biological effects of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico