Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU030031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ddit3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAATAACAGCCGGAACCTGAGGAGAGAGTGTTCCAGAAGGAAGTGCATCTTCATACACCACCACACCTGAAAGCAGAACCTGGTCCACGTGCAGTCATGGCAGCTGAGTCCCTGCCTTTCACCTTGGAGACGGTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGATCTGCAGGAGGTCCTGTCCTCAGATGAAAATGGGGGCACCTATATCTCATCCCCAGGAAACGAAGAGGAAGAATCAAAAACCTTCACTACTCTTGACCCTGCGTCCCTAGCTTGGCTGACAGAGGAGCCAGGGCCAACAGAGGTCACACGCACATCCCAAAGCCCTCGCTCTCCAGATTCCAGTCAGAGTTCTATGGCCCAGGAGGAAGAGGAGGAAGAGCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGTGCCCAGCCCGGCCTGGGAAGCAACGCATGAAGGAGAAGGAGCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

E Aflaki et al.
Cell death & disease, 3, e280-e280 (2012-03-16)
Triacylglycerol (TG) accumulation caused by adipose triglyceride lipase (ATGL) deficiency or very low-density lipoprotein (VLDL) loading of wild-type (Wt) macrophages results in mitochondrial-mediated apoptosis. This phenotype is correlated to depletion of Ca(2+) from the endoplasmic reticulum (ER), an event known
Xin-Yu Zhang et al.
The international journal of biochemistry & cell biology, 68, 158-165 (2015-09-28)
Arsenic trioxide has been proven to trigger apoptosis in human hepatocellular carcinoma cells. Endoplasmic reticulum stress has been known to be involved in apoptosis through the induction of CCAAT/enhancer-binding protein homologous protein. However, it is unknown whether endoplasmic reticulum stress
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Bo Lin Chen et al.
Antioxidants & redox signaling, 23(15), 1233-1245 (2014-09-03)
Renal ischemia-reperfusion (I/R) is a major cause of acute renal failure. The mechanisms of I/R injury include endoplasmic reticulum (ER) stress, inflammatory responses, hypoxia, and generation of reactive oxygen species (ROS). CCAAT/enhancer-binding protein (C/EBP) homologous protein (CHOP) is involved in
Xiuhua Zhang et al.
BMC cancer, 15, 866-866 (2015-11-08)
Prostate cancer is the most commonly diagnosed malignancy among men. The Discovery of new agents for the treatment of prostate cancer is urgently needed. Compound WZ35, a novel analog of the natural product curcumin, exhibited good anti-prostate cancer activity, with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico