Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU026301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nr1h4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTGGAGGCCATGTTTCTTCGTTCGGCGGAGATTTTCAATAAGAAACTTCCTGCCGGACATGCAGACCTGTTGGAAGAAAGAATTCGAAAGAGTGGTATCTCTGATGAGTATATAACCCCGATGTTCAGTTTCTATAAAAGTGTTGGAGAACTCAAAATGACTCAGGAGGAGTACGCTCTGCTCACAGCGATCGTCATCCTCTCTCCAGACAGACAATACATCAAGGACAGAGAGGCGGTGGAGAAGCTGCAGGAGCCCCTGCTTGATGTGCTACAAAAGCTGTGCAAGATGTACCAGCCTGAGAACCCACAGCATTTCGCCTGCCTCCTGGGTCGCCTGACGGAACTCCGGACATTCAACCATCACCACGCTGAGATGCTGATGTCTTGGAGAGTGAATGATCACAAGTTCACCCCGCTCCTCTGTGAGATCTGGGATGTGCAGTGATGGACAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular
Yan-Dong Wang et al.
Molecular endocrinology (Baltimore, Md.), 29(2), 322-331 (2014-12-17)
The farnesoid X receptor (FXR) is a key metabolic and homeostatic regulator in the liver. In the present work, we identify a novel role of FXR in antagonizing c-Jun N-terminal kinase (JNK) signaling pathway in liver carcinogenesis by activating superoxide
Jialin He et al.
Molecular cancer, 14, 163-163 (2015-08-26)
microRNA-122 (miR-122) is the most abundant and specific miRNA in the liver. It acts as an important tumor suppressor in hepatocellular carcinoma (HCC) through regulating its target genes, but details of its own regulation are largely unknown. Farnesoid X receptor

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico