Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU025021

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccrk

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCTAGGAGCACCTCTTTCTGATTTGCCTCCATGGCCTCCCCACGGCTATATATACCACACCTGGTCCTGCTCCTTAGTGTGCTTGAGGGCTGGGCTCTGGGAGGCAGAACCGTGAGATGTTCATCCCAGCAGAGAAAGAGACTCACGTCCTACAGACAAAGCCTCCAGAAACTGCTAGCTGTGTCCTTCTCCAGGGCCACCCCTCAGTGGTGCCACCCGGCCTTAGAGATGATTGTCAGGCTCTGTCCCCTCTTCAAGGACATTGGTACTACAGCACCACCTGGTGGAAGCACAGAGTATAAGCTGTCTTCATACCGGGGACACAGCTGGGAAGTCAGACATGTTTTAGTTTTGGTTCCACTGGGTCAGGATTTGAGGTTCATATAAAAGCCCTGGGTGTTTCTGTCTAATTGCACCTTGTCTGTTGCTGTTAGGGAAAGGACAATGGTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hai Feng et al.
Journal of hepatology, 62(5), 1100-1111 (2014-12-17)
Aberrant chromatin modification is a key feature of hepatocellular carcinoma (HCC), which is characterized by strong sexual dimorphism. Both enhancer of zeste homolog 2 (EZH2) and cell cycle-related kinase (CCRK) contribute to hepatocarcinogenesis, yet whether the two oncogenic factors have
Zhuo Yu et al.
Gut, 63(11), 1793-1804 (2014-01-21)
Androgen receptor (AR) signalling contributes to male predominance in hepatocellular carcinoma (HCC), which is more pronounced in HBV-endemic areas. Cell cycle-related kinase (CCRK) is essential for AR-induced hepatocarcinogenesis but its molecular function in HBV-associated HCC remains obscure. To determine the
Bin You et al.
Oncotarget, 6(6), 4357-4368 (2015-03-05)
Alterations of the EGFR/ERK and Hippo/YAP pathway have been found in non-small cell lung cancer (NSCLC). Herein, we show that ERK1 and ERK2 have an effect on the Hippo/YAP pathway in human NSCLC cells. Firstly, inhibition of ERK1/2 by siRNA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico