Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU021521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tiam1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATGGCAAGAGGGAGAAGGAAGTGGTCTTACCCAGTGTCCACCAGCACAACCCCGACTGTGACATTTGGGTCCATGAATATTTCACTCCATCCTGGTTCTGTCTACCCAACAACCAGCCAGCCTTGACGGTTGTCCGGCCAGGGGACACTGCGAGGGACACCTTGGAGCTCATTTGCAAGACACATCAACTGGATCATTCCGCCCATTACCTGCGCCTGAAATTCCTAATGGAGAACAGAGTGCAGTTCTACATCCCGCAGCCCGAGGAGGACATTTACGAGCTGCTTTACAAAGAAATTGAAATCTGTCCAAAAGTCACCCAGAATATCCACATTGAGAAGTCAGACGCGGCCGCTGATAATTACGGGTTTTTGCTTTCTTCTGTGGATGAAGATGGCATTCGAAGGCTCTACGTGAACAGTGTCAAGGAAACCGGGTTAG

Ensembl | mouse accession no.

ENSMUSG00000002489

NCBI accession no.

NM_001145887

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... TIAM1(21844) , Tiam1(21844)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Minjuan Wu et al.
Clinical science (London, England : 1979), 129(7), 575-588 (2015-05-23)
The homing ability and secretory function of mesenchymal stem cells (MSCs) are key factors that influence cell involvement in wound repair. These factors are controlled by multilayer regulatory circuitry, including adhesion molecules, core transcription factors (TFs) and certain other regulators.
Mina Ding et al.
OncoTargets and therapy, 11, 4367-4375 (2018-08-14)
T-cell lymphoma invasion and metastasis inducing factor 1 (Tiam1) is known to be involved in tumor progression. However, its molecular roles and mechanism in pancreatic ductal adenocarcinoma (PDAC) remain unclear. The purpose of this study is to determine Tiam1 expression
G Zhu et al.
Oncogene, 34(49), 5971-5982 (2015-03-10)
Epidermal growth factor receptor (EGFR) signaling regulates cell growth and survival, and its overactivation drives cancer development. One important branch of EGFR signaling is through activation of GTPase Rac1, which further promotes cell proliferation, survival and cancer metastasis. Here, we
Helen J Whalley et al.
Nature communications, 6, 7437-7437 (2015-06-17)
Centrosome separation is critical for bipolar spindle formation and the accurate segregation of chromosomes during mammalian cell mitosis. Kinesin-5 (Eg5) is a microtubule motor essential for centrosome separation, and Tiam1 and its substrate Rac antagonize Eg5-dependent centrosome separation in early

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico