Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU016691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fis1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGACTGTGGCCCAGTAGAGACCTTAGTGTGAGGCTTTCAGGGGCGGCGGCCATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGATCTGAAGAATTTTGAAAGGAAATTTCAGTCTGAGCAGGCAGCTGGTTCTGTGTCCAAGAGCACGCAATTTGAATATGCCTGGTGCCTGGTTCGAAGCAAATACAATGAGGACATCCGCAGAGGCATCGTGCTGCTGGAGGAGCTGTTGCCCAAAGGGAGCAAAGAGGAACAGCGGGACTATGTCTTCTACCTGGCCGTGGGCAACTACCGGCTCAAGGAATATGAAAAGGCTCTAAAGTATGTGCGAGGGCTGTTGCAGACTGAGCCCCAGAACAACCAGGCCAAGGAGCTGGAACGCCTGATTGATAAGGCCATGAAGAAAGATGGACTGGTAGGCATGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jichi Zhou et al.
Cell stress & chaperones, 24(2), 369-383 (2019-01-19)
Sirtuin 3 (Sirt3)-modified mitochondrial fission participates in the progression of several types of cancers. However, its role in tongue cancer requires investigation. The aim of our study is to determine whether Sirt3 knockdown regulates the viability of tongue cancer cells
Qinfang Shen et al.
Molecular biology of the cell, 25(1), 145-159 (2013-11-08)
Mitochondrial fission is mediated by the dynamin-related protein Drp1 in metazoans. Drp1 is recruited from the cytosol to mitochondria by the mitochondrial outer membrane protein Mff. A second mitochondrial outer membrane protein, named Fis1, was previously proposed as recruitment factor
Dongjoon Kim et al.
Cells, 9(7) (2020-07-16)
Diabetic retinopathy is a prevalent microvascular complication characterized by apoptotic vascular cell loss in the retina. Previous studies have shown that high glucose (HG)-induced mitochondrial fragmentation plays a critical role in promoting retinal vascular cell apoptosis. Here, we investigated whether
Mitsuo Kato et al.
Communications biology, 4(1), 30-30 (2021-01-06)
Diabetic kidney disease (DKD) is a major complication of diabetes. Expression of members of the microRNA (miRNA) miR-379 cluster is increased in DKD. miR-379, the most upstream 5'-miRNA in the cluster, functions in endoplasmic reticulum (ER) stress by targeting EDEM3.
Hidenori Otera et al.
The Journal of cell biology, 191(6), 1141-1158 (2010-12-15)
The cytoplasmic dynamin-related guanosine triphosphatase Drp1 is recruited to mitochondria and mediates mitochondrial fission. Although the mitochondrial outer membrane (MOM) protein Fis1 is thought to be a Drp1 receptor, this has not been confirmed. To analyze the mechanism of Drp1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico