Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU015631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lamp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACATCAGCCCAAATGACACATCTAGTGGGAGTTGCGGTATCAACTTGGTGACCCTGAAAGTGGAGAACAAGAACAGAGCCCTGGAATTGCAGTTTGGGATGAATGCCAGCTCTAGCCTGTTTTTCTTGCAAGGAGTGCGCTTGAATATGACTCTTCCTGATGCCCTAGTGCCCACATTCAGCATCTCCAACCATTCACTGAAAGCTCTTCAGGCCACTGTGGGAAACTCATACAAGTGCAACACTGAGGAACACATCTTTGTCAGCAAGATGCTCTCCCTCAATGTCTTCAGTGTGCAGGTCCAGGCTTTCAAGGTGGACAGTGACAGGTTTGGGTCTGTGGAAGAGTGTGTTCAGGATGGTAACAACATGTTGATCCCCATTGCTGTGGGCGGTGCCCTGGCAGGGCTGATCCTCATCGTCCTCATTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Akhil Kumar Agarwal et al.
Biochemical and biophysical research communications, 449(3), 332-337 (2014-05-23)
Lysosome Associated Membrane Protein-1 (LAMP1), which lines the lysosomes, is often found to be expressed on surface of metastatic cells. We previously demonstrated that its surface expression on B16 melanoma variants correlates with metastatic potential. To establish the role of
Xiang Y Kong et al.
Disease models & mechanisms, 7(3), 351-362 (2014-02-04)
Human kidney predominant protein, NCU-G1, is a highly conserved protein with an unknown biological function. Initially described as a nuclear protein, it was later shown to be a bona fide lysosomal integral membrane protein. To gain insight into the physiological
Takahito Miyake et al.
Glia, 63(10), 1870-1882 (2015-05-27)
Microglia, the resident immune cells in the brain, survey the environment of the healthy brain. Microglial migration is essential for many physiological and pathophysiological processes. Although microglia express some members of the transient receptor potential (TRP) channel family, there is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico