Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU153211

Sigma-Aldrich

MISSION® esiRNA

targeting human TUBB3, RP11-566K11.2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTCTGGTGGACCTGGAACCCGGAACCATGGACAGTGTCCGCTCAGGGGCCTTTGGACATCTCTTCAGGCCTGACAATTTCATCTTTGGTCAGAGTGGGGCCGGCAACAACTGGGCCAAGGGTCACTACACGGAGGGGGCGGAGCTGGTGGATTCGGTCCTGGATGTGGTGCGGAAGGAGTGTGAAAACTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTGGGGGGCGGCACGGGCTCCGGCATGGGCACGTTGCTCATCAGCAAGGTGCGTGAGGAGTATCCCGACCGCATCATGAACACCTTCAGCGTCGTGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACGCTGTCCATCCACCAGCTGGTGGAGAACACGGATGAGACCTACTGCATCGACAACGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sidika Öztop et al.
Anticancer research, 39(2), 655-662 (2019-02-04)
The challenges of cololorectal cancer (CRC) management include prediction of outcome and drug response or chemoresistance. This study aimed at examining whether βIII-tubulin (TUBB3), present in various types of normal tissues and cancer, is a biomarker for the response of
Yohei Sekino et al.
Oncology, 98(10), 689-698 (2020-06-26)
βIII-Tubulin, encoded by the TUBB3 gene, is a microtubule protein. Several studies have shown that overexpression of TUBB3 is linked to poor prognosis and is involved in taxane resistance in some cancers. The aim of this study was to analyze
Mihoko A Tame et al.
Oncotarget, 8(42), 71536-71547 (2017-10-27)
Microtubules are cellular targets for a variety of anticancer therapies because of their critical function in mitosis. Taxol belongs to a class of microtubule targeting agents that suppresses microtubule dynamics and interferes with the functioning of the mitotic spindle, thereby
Qian Liu et al.
Aging, 12(4), 3713-3729 (2020-02-29)
P-glycoprotein (P-gp) and βIII-tubulin overexpression-mediated drug resistance leads to clinical therapy failure for paclitaxel. However, the development of paclitaxel-resistance reversal agents has not had much success. In this study, EM-E-11-4, a lathyrane-type diterpenoid extracted from Euphorbia micractina, demonstrated good anti-MDR

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico