Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU147091

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGTGACCTCGATCCTGAGATTGTAAAGTCATTCCTCTTCCAGCTACTAAAAGGGCTGGGATTCTGTCATAGCCGCAATGTGCTACACAGGGACCTGAAGCCCCAGAACCTGCTAATAAACAGGAATGGGGAGCTGAAATTGGCTGATTTTGGCCTGGCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCTGAGGTGGTCACACTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCTGGGCGGCCTCTTTTTCCCGGCAATGATGTCGATGACCACTTGATCCTTGACTCCGTGGACACACTGCTGGGGACGCCCACCGAGGAGCAGTGGCCCTCTATGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie Zeng et al.
Journal of Cancer, 9(21), 3950-3961 (2018-11-10)
Cyclin-dependent kinase 5 (CDK5), an atypical member of the cyclin-dependent kinase family, plays an important role in the nervous system. Recent studies have shown that CDK5 is also associated with tumors. However, few studies have been done to investigate the
Hailong Tang et al.
International journal of molecular medicine, 45(6), 1661-1672 (2020-04-03)
The emergence of new drugs is a major feature of the treatment history of multiple myeloma (MM), which also reflects the current incurability of MM. As a unique member of cyclin dependent kinase (CDK) family, CDK5 participates in numerous tumorigenic
Johanna Liebl et al.
Nature communications, 6, 7274-7274 (2015-06-02)
The lymphatic system maintains tissue fluid balance, and dysfunction of lymphatic vessels and valves causes human lymphedema syndromes. Yet, our knowledge of the molecular mechanisms underlying lymphatic vessel development is still limited. Here, we show that cyclin-dependent kinase 5 (Cdk5)
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it
Shu Zhang et al.
PloS one, 10(7), e0131833-e0131833 (2015-07-07)
Cyclin-dependent kinase 5 (CDK5) is a cytoplasmic serine/ threonine kinase. Knockdown of CDK5 enhances paclitaxel sensitivity in human ovarian cancer cells. This study explores the mechanisms by which CDK5 regulates paclitaxel sensitivity in human ovarian cancers. Multiple ovarian cancer cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico