Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU136281

Sigma-Aldrich

MISSION® esiRNA

targeting human NPC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTGTGGTGTTGGCTTTTGCCAAATCTCAAATTTTCCAGATATTCTACTTCAGGATGTATTTGGCCATGGTCTTACTGGGAGCCACTCACGGATTAATATTTCTCCCTGTCTTACTCAGTTACATAGGGCCATCAGTAAATAAAGCCAAAAGTTGTGCCACTGAAGAGCGATACAAAGGAACAGAGCGCGAACGGCTTCTAAATTTCTAGCCCTCTCGCAGGGCATCCTGACTGAACTGTGTCTAAGGGTCGGTCGGTTTACCACTGGACGGGTGCTGCATCGGCAAGGCCAAGTTGAACACCGGATGGTGCCAACCATCGGTTGTTTGGCAGCAGCTTTGAACGTAGCGCCTGTGAACTCAGGAATGCACAGTTGACTTGGGAAGCAGTATTACTAGATCTGGAGGCAACCACAGGACACTAAACTTCTCCCAGCCTCTTCAGGAAAGAAACCTCATTCTTTGGCAAGCAGGAGGTGACACTAGATGGCTGTGAATGTGATCCGCTCACTGACACTCTGTAAAGGCCAATCAATGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoyang Xu et al.
Journal of cellular and molecular medicine, 21(2), 364-374 (2016-09-16)
Statins, 3-hydroxyl-3-methylglutaryl coenzyme A reductase inhibitors, are the first-line medications prescribed for the prevention and treatment of coronary artery diseases. The efficacy of statins has been attributed not only to their systemic cholesterol-lowering actions but also to their pleiotropic effects
Yudong Song et al.
Biomaterials, 150, 1-13 (2017-10-14)
Arginine and α-tocopherol succinate (α-TOS) double grafted N-trimethyl chitosan chloride (TMC) nanoparticles (TAS NPs) were designed and developed for effective co-delivery of doxorubicin (DOX) and Survivin shRNA-expressing pDNA (iSur-pDNA). With DOX loading into the hydrophobic core and iSur-pDNA combining to
Saskia Heybrock et al.
Nature communications, 10(1), 3521-3521 (2019-08-08)
The intracellular transport of cholesterol is subject to tight regulation. The structure of the lysosomal integral membrane protein type 2 (LIMP-2, also known as SCARB2) reveals a large cavity that traverses the molecule and resembles the cavity in SR-B1 that
Guanghong Liao et al.
Experimental neurology, 269, 67-74 (2015-04-14)
Niemann-Pick type C (NPC) disease is a genetic disorder associated with intracellular cholesterol accumulation in the brain and other organs, and neurodegeneration is generally believed to be the fatal cause of the disease. In view of the emerging role of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico