Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU134141

Sigma-Aldrich

MISSION® esiRNA

targeting human NFYA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTCATCTGGACCATCGTACTTGCTGTGGCTACTTCTAAGACAATGTAGAGGGTTATTAAACCTTGAAACTGCCTTTCCTAAGTAGAGAACAAGACTATTCAACAACTTCTTTGCTGAAGCACTGAGGAGATTTGTAATACTCCTAAAGGAAGGGCCAAACTAGAGATTTTCAATCATAGACTTTGTGACAGCATTTGGGGAACTAAAAGATTCATGTGTTTCAGCCTAGTGGGAGAGAGTGGGGGAGAGGAAGAGAGAGAGAGAGCATGTATACCCGTATGTTATCATAGAGCACGATTCTCCAGTGGATGGATACCTGGAATGGATCATTAAGATGAAGAGAGTAATTCACATTTACTCTAGAACCTTTAACAAGCACTGAAAGGAAGAAGCCTGAGATTTGATCCTTGACAATTTCTGGAAAGCACTGGTCAGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongxin Ma et al.
Oncotarget, 6(2), 1049-1063 (2014-12-05)
We previously reported the tumor suppressor function of Zinc-fingers and homeoboxes 2 (ZHX2) in hepatocellular carcinoma (HCC). Other studies indicate the association of increased ZHX2 expression with improved response to high dose chemotherapy in multiple myeloma. Here, we aim to
Zhongcheng Shi et al.
Nucleic acids research, 43(13), 6257-6269 (2015-06-05)
Roles for SOX9 have been extensively studied in development and particular emphasis has been placed on SOX9 roles in cell lineage determination in a number of discrete tissues. Aberrant expression of SOX9 in many cancers, including colorectal cancer, suggests roles
Siyuan Ding et al.
PLoS biology, 12(1), e1001758-e1001758 (2014-01-11)
Type III interferon (IFN-λ) exhibits potent antiviral activity similar to IFN-α/β, but in contrast to the ubiquitous expression of the IFN-α/β receptor, the IFN-λ receptor is restricted to cells of epithelial origin. Despite the importance of IFN-λ in tissue-specific antiviral

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico