Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU132881

Sigma-Aldrich

MISSION® esiRNA

targeting human APLNR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCATCATGCTGACCTGTTACTTCTTCATCGCCCAAACCATCGCTGGCCACTTCCGCAAGGAACGCATCGAGGGCCTGCGGAAGCGGCGCCGGCTGCTCAGCATCATCGTGGTGCTGGTGGTGACCTTTGCCCTGTGCTGGATGCCCTACCACCTGGTGAAGACGCTGTACATGCTGGGCAGCCTGCTGCACTGGCCCTGTGACTTTGACCTCTTCCTCATGAACATCTTCCCCTACTGCACCTGCATCAGCTACGTCAACAGCTGCCTCAACCCCTTCCTCTATGCCTTTTTCGACCCCCGCTTCCGCCAGGCCTGCACCTCCATGCTCTGCTGTGGCCAGAGCAGGTGCGCAGGCACCTCCCACAGCAGCAGTGGGGAGAAGTCAGCCAGCTACTCTTCGGGGCACAGCCAGGGGCCCGGCCCCAACATGGGCAAGGGTGGAGAACAGATGCACGAGAAATCCATCCCCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bingyuan Ji et al.
Cellular signalling, 73, 109671-109671 (2020-05-15)
Apelin receptor (APJ) and bradykinin B2 receptor (B2R) play an important role in many physiological processes and share multiple similar characteristics in distribution and functions in the cardiovascular system. We first identified the endogenous expression of APJ and B2R in
Weilin Xu et al.
Journal of neuroinflammation, 16(1), 247-247 (2019-12-04)
Neuroinflammation and oxidative stress play important roles in early brain injury following subarachnoid hemorrhage (SAH). This study is the first to show that activation of apelin receptor (APJ) by apelin-13 could reduce endoplasmic reticulum (ER)-stress-associated inflammation and oxidative stress after
Lu Zhou et al.
American journal of physiology. Endocrinology and metabolism, 316(5), E773-E781 (2019-03-13)
Preeclampsia (PE) is a major cause of maternal mortality and morbidity worldwide. Although there has been great progress in the understanding of PE, the exact cause for the disease development is still unclear. Recently, studies showed that genetic deletion of
Andrew G Masoud et al.
The Journal of clinical investigation, 130(1), 94-107 (2019-11-19)
Sustained, indolent immune injury of the vasculature of a heart transplant limits long-term graft and recipient survival. This injury is mitigated by a poorly characterized, maladaptive repair response. Vascular endothelial cells respond to proangiogenic cues in the embryo by differentiation
Danai Georgiadou et al.
Scientific reports, 9(1), 19077-19077 (2019-12-15)
Preeclampsia is a frequent gestational hypertensive disorder with equivocal pathophysiology. Knockout of peptide hormone ELABELA (ELA) has been shown to cause preeclampsia-like symptoms in mice. However, the role of ELA in human placentation and whether ELA is involved in the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico